Research Article |
|
Corresponding author: Sheng-Mei Yang ( smyang@yzu.edu.cn ) Academic editor: Carolina Arruda Freire
© 2020 Xin Dai, Ling-Yu Zhou, Ting-Ting Xu, Qiu-Yue Wang, Bin Luo, Yan-Yu Li, Chen Gu, Shi-Ping Li, Ai-Qin Wang, Wan-Hong Wei, Sheng-Mei Yang.
This is an open access article distributed under the terms of the Creative Commons Attribution License (CC BY 4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Citation:
Dai X, Zhou L-Y, Xu T-T, Wang Q-Y, Luo B, Li Y-Y, Gu C, Li S-P, Wang A-Q, Wei W-H, Yang S-M (2020) Reproductive responses of the male Brandt’s vole, Lasiopodomys brandtii (Rodentia: Cricetidae) to tannic acid. Zoologia 37: 1-11. https://doi.org/10.3897/zoologia.37.e52232
|
Tannins are polyphenols that are present in various plants, and potentially contain antioxidant properties that promote reproduction in animals. This study investigated how tannic acid (TA) affects the reproductive parameters of male Brandt’s voles, Lasiopodomys brandtii (Radde, 1861). Specifically, the anti-oxidative level of serum, autophagy in the testis, and reproductive physiology were assessed in males treated with TA from the pubertal stage. Compared to the control, low dose TA enhanced relative testis and epididymis weight and sperm concentration in the epididymis, and significantly increased the level of serum superoxide dismutase (SOD), catalase (CAT), and glutathione peroxidase (GSH-Px). mRNA levels of autophagy related genes LC3 and Beclin1 decreased significantly with low dose TA compared to the control. However, compared to the control, high dose TA sharply reduced the levels of serum SOD, GSH-Px, CAT, serum testosterone (T), and mRNA level in steroidogenic acute regulatory protein (StAR) in the testis. Both sperm abnormality and mortality increased with high dose TA compared to the control and low dose TA. Collectively, this study demonstrated that TA treatment during puberty had a dose-dependent effect on the reproductive responses of male Brandt’s voles. TA might mediate autophagy in the testis, through both indirect and direct processes. TA mainly affected the reproductive function of male Brandt’s voles by regulating anti-oxidative levels. This study advances our understanding of the mechanisms by which tannins influence reproduction in herbivores.
Antioxidative, autophagy, puberty, reproduction
Tannins are a group of naturally occurring polyphenols that are widespread in the plant kingdom (
Autophagy (or programmed cell death type 2), is an evolutionarily conserved mechanism involved in the degradation and recycling of misfolded proteins and excess or dysfunctional subcellular organelles (
The Brandt’s vole, Lasiopodomys brandtii (Radde, 1861) is abundant in the grasslands of Inner Mongolia, China. It is a small, gregarious and, mainly, polygynous, seasonally reproductive mammal (from March to September) (
Puberty is a key period in the reproductive development of mammals, with individuals being more susceptible to external factors. Here, we investigated the reproductive responses of male Brandt’s voles treated with different doses of tannic acid (TA) from puberty, with respect to oxidative stress and autophagy, and also examined the dose effects of TA on multiple parameters of these voles. Specifically, we evaluated the body weight, relative testis and epididymis weights, the concentrations of serum reproductive hormones, the activity of serum antioxidative enzymes (SOD, CAT, and GSH-Px), the quality of sperm, and the mRNA levels of autophagy-related genes (Beclin1 and LC3A) and steroidogenic acute regulatory protein (StAR), which encode key enzymes for testosterone synthesis (
Our study was conducted during June-October 2018 at college of Bioscience and Biotechnology, Yangzhou University, China. Brandt’s voles captured from the grasslands of Inner Mongolia were bred as the F0 generation in the animal group facility at Yangzhou University, Jiangsu Province, China. Environmental conditions were controlled at a temperature of 22 ± 1 °C, a relative humidity of 50 ± 5%, and a photoperiod of 12 hours light/12 hours dark (light period extending from 6:00 am to 6:00 pm). At 21 days of age, F1 generation male voles were weaned and housed separately in polypropylene cages, and were allowed to acclimate for another seven days until four weeks of age. Each pubertal vole was provided with 10 mL filtered tap water and rodent chow (containing 318.65 ± 29.81 μg/g tannin) ad libitum during this period. The nutrient contents of the rodent chow were as follows: crude protein, ≥18%; crude fat, ≥4%; crude fiber, ≥5%; ash, ≤8%; calcium, 1.0%–1.8%; and phosphorus, 0.6%–1.2%. Following acclimation, a cohort of 18 voles was randomly assigned to one of three groups (control, low dose, and high dose), with the same number of individuals in each group. The experiment lasted for four weeks.
A stock solution (6 mg/mL TA) was prepared by dissolving 3 g TA (Tianjin Kemiou Chemical Reagent Co., Ltd.) in 500 mL filtered tap water, and was stored at 4 °C. On the day of administration, the stock solution was brought to room temperature and diluted 2-fold with filtered tap water to obtain 3 mg/mL TA solution. The voles in each group received 10 mL filtered tap water (control group), 3 mg/mL TA solution (low dose group), and 6 mg/mL TA solution (high dose group), respectively, every two days. In the field, the average tannin contents per dry weight of the most preferred food plant species – Leymus chinensis (Trin.) Tzvel, 1968, Setaria viridis Beauv., 1817, and Medicago sativa Linn., 1753 – during the period from May to August are approximately between 3 mg/g and 7.5 mg/g (
Voles were weighed every week from four weeks to eight weeks in age. At eight weeks in age, all animals were weighed and decapitated after anesthetizing with ether. Blood samples were collected and kept at 4 °C overnight. Paired testes and epididymides were collected and weighed as soon as possible using a precision scale balance (± 0.001 g; ML203T/02, Mettler Toledo Co., Shanghai, China). Relative testis and epididymis weight were calculated as paired testes and epididymides weight (g) divided by body weight (g). After weighing, paired testes were immersed in RNA preservation liquid, and stored at −20 °C. The left epididymis was used to detect the concentration, mortality, and abnormality rate of sperm. Then, the serum was obtained by centrifugation at 3000×g for 30 minutes, and was stored at −80 °C. All procedures were approved by the Animal Care and Use Committee of the Faculty of Veterinary Medicine of Yangzhou University.
All procedures in our experiment were approved by the Animal Care and Use Committee of the Faculty of Veterinary Medicine of Yangzhou University.
The sequences we cloned have been submitted to GenBank as partial mRNA sequence for each gene (accession numbers for LC3A and Beclin1 were MK477699 and MK477700, respectively).
After weighing, the left epididymis isolated from each vole was immediately placed in 2 mL 0.01 M PBS, which had been warmed to 37°C. The caudal epididymis was cut open with eye scissors to release epididymal fluid. Then, the exuded epididymal fluid was incubated for three minutes at 37 °C. A 100 µL volume of diluted epididymal fluid was collected for staining using Typan Blue Staining Cell Assay Kit (Beyotime, China), according to manufacturer’s instructions. A 10 µL solution was placed to a hemocytometer to determine sperm concentration and quantify the rate of sperm abnormality and mortality under a light microscope (20× objective). In total, 40 µL solution was checked for each epididymis. Sperm concentration was expressed in millions per mL. Dicephaly, double tails, short tail, microcephalic, and megacephalic sperm were defined as abnormal sperm based on
Serum hormones, were quantified in duplicate using an ELISA kit (LianShuo Biological Technology Co., Ltd., Shanghai, China), according to the manufacturer’s instructions, and as previously reported (
Total RNA was extracted and stored using the procedure established in our previous study (
All variables were tested for normality and homogeneity by the Shapiro-Wilk and Levene test, and were transformed by log10, when necessary. The effect of TA doses on the body mass of voles was evaluated using repeated measures analysis, in which body weight on the fourth week was the covariate, followed by the least significant difference (LSD) post hoc test. The effect of TA on autophagy related gene expression in the testis, relative testis weight, expression of StAR in testis, serum hormones, serum enzymatic activities, and sperm quality parameters was determined using one-way analysis of variance (ANOVA) followed by the LSD test. Statistical significance was determined at p < 0.05. All analyses were performed using SPSS 16.0 (SPSS Inc., Chicago, IL, USA).
| Forward (5’–3’) | Reverse (5’–3’) | Reference | |
| LC3A | GCTTCGCCGACCGCTGTAA | ATCCGTCTTCATCCTTCTCCTG | Designed in the present study |
| Beclin1 | GGTCGCTTGCCCAGTGTT | ACGGCAACTCCTTAGATT | |
| StAR | GGTCCTGCAAAAGATCGGGAA | GGCATCTCCCCAAAATGTGTG |
|
| β-actin | TTGTGCGTGACATCAAAGAG | ATGCCAGAAGATTCCATACC | |
| GAPDH | TGGCAAAGTGGAGATTGTTGCC | AAGATGGTGATGGGCTTCCCG |
The body weight of voles did not differ significantly among the three groups (F2, 32 = 0.574, p = 0.569) (Fig.
Sperm density differed significantly among the three groups (F2, 15 = 5.080, p = 0.021), with the low dose TA group having higher sperm density than the control group (p = 0.006) (Fig.
The concentration of serum LH differed significantly among the three groups (F2, 15 = 9.370, p = 0.002), with the control group having lower serum LH than the low dose and high dose TA groups (p = 0.001 and p = 0.015, respectively; Fig.
GSH-Px levels in serum differed significantly among the three groups (F2, 15 = 40.822, p < 0.001), with the high dose TA group having lower GSH-Px activity than the control and low dose TA groups (p < 0.001, for both comparisons). Also, GSH-Px levels were lower in the control group compared to the low dose TA group (p = 0.034) (Fig.
The mRNA level of LC3A differed significantly among the three treatment groups (F2, 15 = 12.718, p = 0.001), with the low dose TA group having lower LC3A mRNA levels than the control group (p = 0.010) and high dose TA group (p < 0.001; Fig.
The effect of TA on the reproductive organ weight. Relative testis weight (2) and relative epididymis weight (3) of male Lasiopodomys brandtii provided low dose (3 mg/mL) and high dose (6 mg/mL) tannic acid (TA). Error bars indicate standard error. Same letters connect bars with no significant differences at p < 0.05 (n = 6). Note: Relative testis and epididymis weight were calculated as paired testes and epididymis weight (g) divided by body weight (g).
The effect of TA on the sperm quality. Sperm density (4), Sperm abnormality rate (5), and Sperm mortality rate (5) in the epididymis of male Lasiopodomys brandtii provided low dose (3 mg/mL) and high dose (6 mg/mL) tannic acid (TA). Error bars indicate standard error. Same letters connect bars with no significant differences at p < 0.05 (n = 6).
The effect of TA on the reproduction-related hormones concentration and StAR expression. Concentrations of luteinizing hormone (LH) (6), follicle-stimulating hormone (FSH) (7), and testosterone (T) (8) in the serum and relative mRNA expression levels of steroidogenic acute regulatory protein (StAR) (9) in the testes of male Lasiopodomys brandtii provided low dose (3 mg/mL) and high dose (6 mg/mL) tannic acid (TA). Error bars indicate standard error. Same letters connect bars with no significant differences at p < 0.05 (n = 6).
The effect of TA on the content of anti-oxidative enzymes in serum. GSH-Px (10), CAT (11), and SOD (12) level in the serum of male Lasiopodomys brandtii provided low dose (3 mg/mL) and high dose (6 mg/mL) tannic acid (TA). Error bars indicate standard error. Same letters connect bars with no significant differences at p < 0.05 (n = 6).
The effect of TA on the expression of autophagy-related genes. Relative mRNA expression levels of LC3A and Beclin1 in the testes of male Lasiopodomys brandtii provided low dose (3 mg/mL) and high dose (6 mg/mL) tannic acid (TA). Error bars indicate standard error. Same letters connect bars with no significant differences at p < 0.05 (n = 6).
Our study demonstrates that TA significantly affects the activity of antioxidative enzymes, sperm quality, reproductive organ weight, serum sex hormone, and autophagy in the testis of male Brandt’s voles. Drinking water containing TA for four weeks did not have any significant difference on body weight. Consistently, Brandt’s voles supplemented with 3% TA in their diet for five weeks showed minimal variation in body weight to the control (
The relative testis and epididymis weight, serum luteinizing hormone, and the sperm concentration was highest in the low dose TA group in this study. Our previous study showed that giving tannic acid by intragastric administration increases serum T concentrations in plateau pikas, Ochotona curzoniae (Hodgson, 1858), and root voles, Microtus oeconomus (Pallas, 1776) (
SOD is mainly responsible for converting superoxide radicals to H2O2 and molecular oxygen. H2O2 is converted by GSH-Px and CAT into harmless water (
Both spermatogenesis (
Compared to the control, the mRNA levels of LC3A and Beclin1 significantly decreased in the testis of low dose TA group voles in this study. Thus, low dose TA might reduce autophagy activity in the testis of adolescent Brandt’s voles, supporting our hypothesis that tannins mediate autophagy. The autophagy pathway represents an alternative approach to achieving more desirable antioxidative effects, without perturbing the redox signaling pathway, through clearing damaged proteins and organelles generated by diverse oxidants (
In summary, our study demonstrated that lower doses of TA enhance anti-oxidative levels and reduce autophagy in the testis, in turn, enhancing the reproductive capability of male Brandt’s voles treated with TA from the pubertal stage. In comparison, higher dose of TA cause anti-oxidative levels to decrease, thus impairing spermatogenic and steroidogenic functions. TA might mediate autophagy in the testis through indirectly regulating anti-oxidative levels and directly inhibiting autophagy. Our study showed that TA mainly affects the reproductive function of male Brandt’s voles by regulating anti-oxidative levels, with the direct effect of TA on autophagy impacting the reproductive capacity of Brandt’s voles. Our study provides new insights on the mechanism by which plant secondary metabolites affect the reproduction of herbivores and how plant secondary metabolites regulate herbivore populations.
This work was supported by the National Science Foundation of China (31470017 and 31770422), and First-class General Financial Grant from the China Postdoctoral Science Foundation (2015M580476).