The response mechanism and interaction patterns of HIF-1α and p53 in animals in an hypoxic environment are crucial for their hypoxic tolerance and adaptation. Many studies have shown that underground rodents have better hypoxic adaptation characteristics. However, the mechanism by which HIF-1α and p53 in underground rodents respond to hypoxic environments compared with in ground rodents remains unclear. Further, whether a synergy between HIF-1α and p53 enables animals tolerate extremely hypoxic environments is unclear. We studied HIF-1α and p53 expression in the brain tissue and cell apoptosis in the hippocampal CA1 region during 6 hours of acute hypoxia (5% oxygen) in Lasiopodomys mandarinus (Milne-Edwards, 1871) and Lasiopodomys brandtii (Radde, 1861), two closely related small rodents with different life characteristics (underground and aboveground, respectively), using a comparative biology method to determine the mechanisms underlying their adaptation to this environment. Our results indicate that HIF-1α and p53 expression is more rapid in L. mandarinus than in L. brandtii under acute hypoxic environments, resulting in a significant synergistic effect in L. mandarinus. Correlation analysis revealed that HIF-1α expression and the apoptotic index of the hippocampal CA1 regions of the brain tissues of L. mandarinus and L. brandtii, both under hypoxia, were significantly negatively and positively correlated, respectively. Long-term existence in underground burrow systems could enable better adaptation to hypoxia in L. mandarinus than in L. brandtii. We speculate that L. mandarinus can quickly eliminate resulting damage via the synergistic effect of p53 and HIF-1α in response to acute hypoxic environments, helping the organism quickly return to a normal state after the stress.

Comparative biology, hippocampal CA1 region, oxygen, subterranean rodents

Oxygen is essential for the metabolism of most living organisms; in particular, it is the basis for the growth and reproduction of aerobic organisms. In many vertebrates, a brief period of lack of oxygen in the brain can irreversibly damage the neurons (Larson et al. 2014). There are many hypoxic environments in the nature, including aquatic habitats (Jackson and Ultsch 2010), high-altitude locations (Qiu et al. 2012), underground burrow systems (Roper et al. 2001), and tumor microenvironments (Gilkes et al. 2014, Spill et al. 2016). Most organisms who have lived in hypoxic environments for a long time have developed several adaptive features. For example, the adaptive characteristics in subterranean rodents are manifested by the convergence of numerous physiological, morphological, behavioral, and genomic features (Šumbera et al. 2004, Kim et al. 2011, Nevo 2013).

Subterranean rodents naturally live in enclosed, hypoxic underground tunnels that present many challenges, including severe hypoxia and limited food availability during extended periods of rain or when the soil freezes during winter. Subterranean rodents have evolved strategies and features to address these environmental obstacles (Shams et al. 2005). For example, during the rainy season, Spalax carmeli Nevo, Ivanitskaya & Beiles, 2001 (Rodentia: Spalacidae) can maintain normal life activities in an extremely low-oxygen environment of 7.2% (Shams et al. 2005). Further, Spalax ehrenbergi Nehring, 1898 (Rodentia: Spalacidae) can survive for more than 11 hours in an extreme, 3% hypoxic environment, whereas rats can only survive for 2.5 hours in such an environment (Avivi et al. 1999).

In recent years, the molecular mechanisms underlying the response to hypoxia, which includes differential expression of genes encoding hemoglobin, hypoxia-inducible factor-1 (HIF-1), erythropoietin, and vascular endothelial growth factor and the tumor suppressor gene p53, have extensively been studied (Shams et al. 2004, 2005, Schmidt et al. 2017, Dong et al. 2018). Among them, HIF-1, a specific dimer composed of HIF-1α and HIF-1β, regulates the expression of various target genes in a hypoxic environment (Semenza et al. 1997, Zoccola et al. 2017). HIF-1α can bind to p53 and promote p53-dependent cell apoptosis in a hypoxic environment (Suzuki et al. 2001, Zoccola et al. 2017); this may be critical for adaptation to hypoxic environments and inhibit primary tumor growth (Graeber et al. 1994, Nevo et al. 1999, Suzuki et al. 2001, Vousden 2002 Vousden and Lu 2002). Compared with ground rodents, underground rodents, such as the species of Spalax (Malik et al. 2012, 2016) as well as Heterocephalus glaber Rüppell, 1842 (Rodentia: Bathyergidae) (Park et al. 2017, Husson and Smith 2018), have evolved unique neuroprotective mechanisms for survival in hypoxic conditions. Besides, previous research has demonstrated that Lasiopodomys mandarinus (Milne-Edwards, 1871) (Mandarian vole) can adapt to chronic hypoxic environments by increasing oxygen transport capacity and modulating oxygen consumption

(Dong et al. 2018). In addition to being highly adaptable to hypoxic environments, most subterranean rodents, including the naked mole rat, H. glaber, and blind mole rat, Spalax spp., both of which have strong tumor-suppressing features (Manov et al. 2013, Fang et al. 2014, Gorbunova et al. 2014, Fang et al. 2015). The study on anti-tumor activity in subterranean rodents via molecular biology mainly focused on the regulation and molecular pathways of tumor suppressor genes. p53 can induce cell cycle arrest, repair DNA damage, and promote apoptosis. Both DNA damage repair and apoptosis can reduce the damage caused by hypoxia (such as brain tissue damage) in subterranean rodents. These two pathways are considered the molecular regulation pathways of tumor suppression in subterranean rodents, which are induced by hypoxia or DNA damage (Hammond and Giaccia 2005, Johnson et al. 2005, Morgunkova 2005, Hammond et al. 2006, Prabha et al. 2012).

Lasiopodomys mandarinus is a rodent that lives in chronic hypoxic and dark underground tunnel systems and is widely distributed throughout northeast and central China and north central Mongolia as well as the adjacent areas of Siberia, south of Lake Baikal, and the southern and central Korean Peninsula (Dong et al. 2018, Hong et al. 2019). Oxygen levels in the natural tunnels of these typical subterranean species can reduce to as low as 16.04% in the summer, with further reductions during the rainy season (Hong et al. 2019). This species exhibits remarkable physiological adaptations to hypoxic environments, including increased capillary density and elevated levels of blood parameters such as hematocrit, mean corpuscular volume, and mean corpuscular hemoglobin concentration (Liu et al. 2010). Conversely, Lasiopodomys brandtii (Radde, 1861) (Brandt’s vole), a species closely related to L. mandarinus, is mainly distributed in the grasslands of middle-eastern Inner Mongolia, eastern regions of Mongolia, and some parts of southern Russia (Zhang et al. 2003) and spends most of its life above ground. As L. mandarinus and L. brandtii have a close evolutionary relationship and distinct life histories, they are ideal animal models for comparatively studying the mechanisms underlying the adaptation to hypoxia in subterranean mammals.

Brain tissues are extremely susceptible to hypoxia; hypoxic damage to the nervous system and brain tissues is often irreversible. For example, hypoxia can induce cerebral vascular stenosis or even occlusion, hindering oxidative metabolism and energy supply; this results in permanent damage to the nervous system and brain parenchyma. In addition, hypoxia can lead to the accumulation of specific metabolites, such as vasopressin, in tissues, resulting in increased intracranial pressure, brain edema, severe cell metabolism disorders, and brain atrophy (Terraneo and Samaja 2017). Therefore, if a hypoxia-intolerant animal is exposed to hypoxia, its nervous system and brain development may be affected. In addition, the hippocampal CA1 region, an important structure in the limbic system of the brain, is significantly related to the cognition and learning ability of animals and is very sensitive to external environmental stresses, such as hypoxia. Therefore, in the present study, we exposed the voles to acute hypoxic environmental stress (5% oxygen) for 6 hours and measured the expression levels of HIF-1α and p53 in their brain tissues and the apoptosis index in the hippocampal CA1 region during the following month of normal oxygen levels in order to explore how HIF-1α and p53 help the two types of voles to respond to acute hypoxic exposure and whether the two have a synergistic effect. Further, we investigated the differences in the response mode of HIF-1α and p53 in the two voles and whether such difference helps the animals tolerate extremely hypoxic environments.

Lasiopodomys mandarinus was trapped from croplands in Xinzheng, Henan, China (N 34°52’, E 113°85’); L. brandtii was obtained from the Chinese Academy of Agricultural Science. They were maintained in polycarbonate cages (37×26×17 cm³) on a 14:10 hours light/dark cycle at 20–24 °C for at least one month. Rat and rabbit feed (produced by Henan experimental animal center, Zhengzhou, China) with fresh carrots was made regularly available during feeding periods. According to their typical social systems, L. mandarinus were monogamously raised and L. brandtii were raised in groups. The two vole species were housed in separate rooms to prevent odor interference. All animals were maintained in the laboratory at the School of Life Sciences, Zhengzhou University, for more than one generation.

To mimic acute hypoxic environmental stress, 72 three month old healthy adult male voles (n = 36 of each species) were randomly divided into the following six groups (n = 6 of each species): normoxia (20.9% oxygen for 6 hours), hypoxia A (5% acute hypoxia for 6 hours with no oxygen restoration), hypoxia B (5% acute hypoxia for 6 hours followed by 12 hours of normal oxygen levels), hypoxia C (5% acute hypoxia for 6 hours followed by 24 hours of normal oxygen levels), hypoxia D (5% acute hypoxia for 6 hours followed by 14 days of normal oxygen levels), and hypoxia E (5% acute hypoxia for 6 hours followed by 28 days of normal oxygen levels). Individuals in the normoxic group were also placed in an unopened oxygen chamber for 6 hours. Except for the oxygen content, all other environmental conditions remained the same for all groups. Acute hypoxia was simulated using a DS-II hyperbaric cabin (Huaxin Hyperbaric Cabin, Weifang, China). The oxygen level in the cabin was maintained at a constant level by balancing oxygen and nitrogen flow rates and was monitored using an oximeter. A bottle containing sodium hydroxide was placed in the cabin to absorb the carbon dioxide released by the animals. All experiments were conducted in the morning to avoid the effects of different circadian rhythms on the animals. Immediately after treatment completion, the animals were sacrificed via an overdose of pentobarbital sodium (30 mg/kg). The brain tissues of the experimental animals were quickly removed and the CA1 region was quickly separated from the hippocampus. Whole-brain tissues were placed in an ultra-low temperature freezer at -80 °C until RNA extraction by grinding the tissues in liquid nitrogen. On the other hand, the CA1 regions were fixed in 4% paraformaldehyde and stained using the TUNEL (Roche, China) method.

Total RNA was extracted from the brain tissue of each animal using TRIzol reagent (Invitrogen, Carlsbad, CA, USA), according to the manufacturer’s instructions. Residual DNA was removed by treatment with RNase-free DNase I (Takara Bio, Dalian, China). RNA integrity was verified via agarose gel electrophoresis (1.2%), and RNA concentrations were measured using an Agilent 2100 Bioanalyzer (Agilent Technologies, Santa Clara, CA, USA).

The total RNA extracted from the brain tissues was reverse-transcribed into cDNA using a reverse transcription kit (Takara Bio). The obtained cDNA was stored at -20°C for the subsequent real-time PCR.

The HIF-1α and p53 sequences of the near relatives of L. mandarinus were determined and compared with their corresponding sequences in the National Center for Biotechnology Information before designing their primers for real-time PCR usingthe Primer3 online software (Rozen and Skaletsky 1999, Schmittgen and Livak 2008). The primers were further verified via sequencing after the PCR products were assembled into cloning vectors. The details of the primers are shown in Table 1.

Real-time PCR was performed on a Rotor-gene 3000 fluorescence quantitative PCR instrument (Corbett Research, Germany) with a default reaction procedure configuration. The reaction volume was 20 μL and included 0.5 μL each of specific forward and reverse primers (20 μM), 2 μL of the diluted cDNA template, 1 μL of the PrimeScript RT Enzyme Mix, 6 μL of the 5× PrimeScript Buffer, and 10 μL of RNase-free H₂O. β-actin was used as the internal control gene (forward: GTCGTACCACTGGCATTGTG; reverse: CCATCTCTTGCTCGAAGTCC), and relative gene expression was determined using the comparative CT method (Untergasser et al. 2012).

Paraffin sections of the brain tissue were prepared after fixing the brain tissue of each animal in paraformaldehyde. These dewaxed and hydrated brain tissues were stained using a TUNEL method (Lozano et al. 2009). Cells with brown-yellow granules in the nucleus were identified as positive apoptotic cells under a microscope (Leica DMI8M, Germany). For each TUNEL-stained section, five fields of view were randomly selected, and the percentage of apoptotic cells in each field was calculated at high magnification (×400).

All data were analyzed using SPSS (version 22.0, SPSS Inc., USA) and presented as mean ± SE. p < 0.05 denoted statistical significance. The data were initially checked for homogeneity of variance. If appropriate, the statistical significance between different groups was assessed using two-way ANOVA followed by Duncan’s post-hoc tests. If heterogeneity of variance existed between the groups, the Kruskal–Wallis test followed by the Mann–Whitney U post-hoc test was used for comparing the differences between the groups (Buchley 2006).

The experimental protocol was approved by the Animal Care and Use Committee of Zhengzhou University (Approved project number: 31372193) and in accordance with the Guide for the Care and Use of Laboratory Animals of China.

Luye Shi and Mengwan Jiang are the co-first authors of this paper, they contributed equally to this work. This work was supported by a fellowship from China Postdoctoral Science Foundation (process 2020M672264). We thank Zishi Wang, Dan Pan, and Shiming Gu for feeding the experimental animals.