Research Article |
|
Corresponding author: Guangwen Chen ( chengw0183@sina.com ) Academic editor: Carolina Arruda Freire
© 2018 Zimei Dong, Changying Shi, Gengbo Chu, Yanping Dong, Guangwen Chen, Dezeng Liu.
This is an open access article distributed under the terms of the Creative Commons Attribution License (CC BY 4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Citation:
Dong Z, Shi C, Chu G, Dong Y, Chen G, Liu D (2018) Morphological changes of gonad and gene expression patterns during desexualization in Dugesia japonica (Platyhelminthes: Dugesiidae). Zoologia 35: 1-7. https://doi.org/10.3897/zoologia.35.e21933
|
Planarians, the representatives of an ancient bilaterian group with complex reproductive system and high regenerative capabilities, are model system suitable for studying the basic molecular requirements for the development of the reproductive system. To further explore the morphological changes of the gonads during desexualization and the molecular events of the genes controlling the reproductive system development in planarians, we have investigated the histological changes of ovary and testis by paraffin section and the expression patterns of reproductive-related genes by the quantitative real-time PCR in Dugesia japonica Ichikawa & Kawakatsu, 1964, upon starvation. The four genes, Djprps, DjvlgA, DjvlgB and Djnos, have been selected. The research results show that the degradation of ovary changes from outside layer to inside, and the testis changes are opposite; the reproductive capacity of the planarians starts to be damaged from the 17th to 25th days and to disappear completely from the 26th to 37th days during starvation. The expression patterns of the four genes exhibit the obvious dynamic variations during their desexualization, which indicates that these genes might be involved in gonad development.
Planarian, food deprivation, germ cells, reproductive system
Organisms have their definite and unique reproductive system to propagate and maintain their species, and asexual and sexual reproductions, which are two types of reproductive mode, have been formed in the process of biological evolution (
The reproductive system of D. japonica consists of the male and female gonads as well as accessory reproductive organs (
The existence of the two divergent modes of reproduction in a single species presents a unique opportunity to study reproductive-related genes. Up to now, a large number of reproductive-related genes have been isolated in planarians, such as DjFGFR2, vasa-like, DeY1, Dryg, nanos, piwi and DjPRPS. These genes are expressed in the reproductive system of sexual worms and are involved in the formation of reproductive system (
This study has investigated the morphological changes of the ovary and testis during the reproductive system degeneration induced by starvation in D. japonica, and simultaneously, analyzed the dynamic expression patterns of the four genes (Djprps, DjvlgA, DjvlgB and Djnos) by the real-time PCR. This research has provided the basic data to explore the mechanism of planarian reproduction.
The planarians used in this study belong to the sexual strain of the species D. japonica, collected from Yuquan Spring, Henan Province, China. Animals were fed beef liver once every six days and cultured in autoclaved tap water in dark at 22 °C. To induce the sexual worms desexualization, they were starved for 6 (the control), 16, 25, 37 and 44 days, respectively. The date when they were last fed was regarded as the 0 day after starvation.
Paraffin section of the gonads was performed as described previously (
Quantitative real-time PCR was carried out as described previously (
| Genes | Primers | Sequences(5’–3’) |
|---|---|---|
| Djprps | DjPrps F | TCAGGCGTCTATGTGATTGCTACT |
| DjPrps R | AGACCGATTCGCCGTAATGTAT | |
| DjvlgA | DjvlgA F | GTTAGTGCGTCCTTGCGTGGT |
| DjvlgA R | GTTGTCCAGGAGGCGGCAT | |
| DjvlgB | DjvlgB F | CTACATTCAATAGACAACAGGCTCC |
| DjvlgB R | TTGTTGGTGATGGATGGGTTC | |
| Djnos | Djnos F | GGAAGATGACCACGACAAC |
| Djnos R | GCTTCGGTCCAGTGTTATGT |
For sexual maturity individuals, the outer layer of the ovary includes a lot of round, small, basophilic cells, which are oogoniums. Many larger oocytes are clearly visible within the ovary, and their nucleus deviate from the central part of the cell (Fig.
Histological changes of the ovary during starvation. The ovary of on the day 25th is sagittal section and the others are horizontal section. The yellow lines indicate the innermost region and the oogoniums marked by black arrows, d: days after starvation, og: oogonium, oc: oocyte. Scale bar: 200 μm.
The testis can be obviously divided into two layers: the larger spermatogoniums and spermatocytes are in the outer layer, while the spermatids and spermatozoa, spindle and basophilic, occupy the inner region (Fig.
Sagittal section of testis during starvation. The blue lines indicate the innermost region and the yellow lines indicate that the border between the testis region and the surrounding tissue. d: days after starvation, sg: spermatogonium, sc: spermatocyte, st: spermatid, sp: spermatozoa. Scale bar: 100 μm.
There is no difference in the morphology and histology of the gonads on the 6th day after starvation compared with those of 0 day. In order to avoid the influence of the undigested food, the expression levels of the genes on the 6th day after food deprivation are used as the control. This study has adopted four reproductive-related genes, Djprps, DjvlgA, DjvlgB and Djnos, and has observed their expression levels during the gonads degradation.
The research results show that the four genes have the similar expression patterns. Their expression levels reduce gradually from the 6th day, reach the lowest levels on the 25th day, and then their expression levels increase. The expression levels of Djprps and Djnos reach the peak on the 44th day after starvation (Figs
The time-course expressions of four genes during starvation by real-time PCR: (3) Djprps; (4) DjvlgA; (5) DjvlgB; (6) Djnos. The expression levels on the day 6th after the last feeding were used as the control, β-actin was used as inter-control. d: days after starvation. Vertical bars represented the mean ± SD (N = 3). Asterisks indicate statistical differences (*p < 0.05, **p < 0.01).
Freshwater planarians exhibit strong tolerance to prolonged starvation. An adult worm can still survive after several months of starvation, but the reproductive system of the worm disappears gradually in the process of starvation due to maintaining the individual normal function, that is, the desexualization is induced by starvation. The significant changes of the gonads are observed during the desexualization, which are divided into three stages. On the first stage, from the 0 to 16th days, the ovaries and testes grow smaller, and the oogoniums, spermatid and spermatozoa begin to reduce in number. On the second stage, from the 17th to 25th days, the number of the mature sperms and oogoniums decreases dramatically, and some oocytes are damaged. On the third stage, from the 26th to 44th days, the oogoniums and the mature sperms continue to decrease until they disappear completely, and most oocytes are damaged and the boundary of the spermatogoniums is not clear. What is more, the different changes of the ovary vary from the testis during desexualization, and the oogoniums start to degenerate until they disappear in the ovary. Instead, for the testis, the mature sperms start to decrease, but the spermatogoniums can be kept for a longer time. This is a very interesting phenomenon, although the mechanism is unknown. Based on the comprehensive analysis, this study draws a hypothesis conclusion that the reproductive capacity of planarian damages on the second stage and disappears completely on the third stage.
In order to explore the expression patterns of the reproductive-related genes during starvation, this study focuses on the four genes involved in reproductive system development and monitors their expressions by quantitative real-time PCR. Their expression levels reduce gradually from the 6th day and reach the lowest levels on the 25th day, which is the critical stage when the reproductive capacity of planarian is damaged. As a result, we think these genes play important roles during the gonad development. However, their transcripts are up-regulated unexpectedly on the 37th or 44th day after starvation. Meanwhile the gonads continue their degradation on this stage. The precise function of each gene in the gonad remains unknown, and needs to be worked out in the future research of the planarians.
The prps gene has been cloned from planarians Dugesia. Ryukyuensis Kawakatsu, 1976 and D. japonica, respectively. Its spatial expression is in bilateral lines of patches in the ventral side where are located the ovary and the yolk glands of sexual worms, which indicates that prps might be one of sexual reproduction related genes in planarians (
Vasa, a member of the ATP-dependent DEAD-box RNA helicase family, is a prototypic marker of the primordial germ cells and of the germ line in the metazoan (
The nanos gene encodes an RNA-binding protein containing a zinc finger motif, which is conserved in diverse metazoan (
Of course, it is important to note that these genes might be pleiotropic, which means that they also serve an apparently different function elsewhere apart from their role in gonad formation (
In conclusion, this study finds out the histological changes of the testis and the ovary and the different expression patterns of reproductive-related genes during desexualization by starvation. The results of this research suggest that the degradation of the ovary is from the outside layer to the inside whereas the testis is opposite. Gonad degradation results from the polygenic services and the reproductive-related genes might play important roles during desexualization. In order to better understand the molecular basis of the planarian gonad degradation, it might be of great use and significance to further analyze the interactions of these genes in the network apart from the function of every gene during desexualization.
We thank Yunxiang Chen for editing the manuscript. This research was supported by grants from the National Natural Science Foundation of China (processes 31570376, 31471965 and u1604173), the Program for Innovative Research Team in University of Hennan Province (process 18IRTSTHN022).